class A penicillin-binding protein 1A/1B, contributes to cell elongation and cell division

class A penicillin-binding protein 1A/1B, contributes to cell elongation and [SW|cell division], required for the control of cell diameter (together with the [SW|Rod complex])

BSU22320

BSU_22320

2742

2745

bifunctional glucosyltransferase/ transpeptidase

bifunctional glucosyltransferase/ transpeptidase, polymerizes and cross-links peptidoglycan

penicillin-binding protein 1A/1B

penicillin-binding protein 1A/1B, member of the [SW|divisome]

BSU22320

BSU_22320

2,341,444 → 2,344,188

2,341,444 2,344,188

prevents bulging of the cells when grown at low Mg(2 ) concentrations, suppresses the lethal effect of a ''[[gene|mreB]]'' mutation [Pubmed|19192185]

deletion of ''ponA'' restores growth and normal shape of a ''[[gene|glmR]]'' mutant on gluconeogenic carbon sources [Pubmed|21320184]

prevents bulging of the cells when grown at low Mg²⁺ concentrations, suppresses the lethal effect of a [[gene|mreB]] mutation [Pubmed|19192185]

deletion of [[gene|ponA]] restores growth and normal shape of a [[gene|glmR]] mutant on gluconeogenic carbon sources [Pubmed|21320184]

a strain lacking all four class A [SW|penicillin-binding proteins] ([[gene|ponA]] [[gene|pbpD]] [[gene|pbpF]] [[gene|pbpG]]) is severely inhibited for L-form switching in the presence of D-cycloserine [pubmed|29456081]

membrane associated [Pubmed|18763711]

localizes to the spore septum during sporulation [Pubmed|15758244,15262952]

localizes to the vegetative septum [Pubmed|15262952], this depends on [[protein|GlmR]] [Pubmed|21320184]

membrane associated [Pubmed|18763711]

anchored to the membrane, the major part is exposed to the outside (according to UniProt)

localizes to the spore septum during sporulation [Pubmed|15758244,15262952]

during vegetative growth: septal, low flourescence at periphery [pubmed|14731276]

localizes to the vegetative septum [Pubmed|15262952], this depends on [[protein|GlmR]] [Pubmed|21320184]

[SW|Jeff Errington], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/jeff.errington homepage]

8606187, 15262952, 9721295, 10322023, 7814321, 18363795, 14731276, 21320184, 18763711, 19192185, 18179421, 23531131, 18363795

8606187, 15262952, 9721295, 10322023, 7814321, 18363795, 14731276, 21320184, 18763711, 19192185, 18179421, 23531131, 18363795, 18760285, 29456081, 30651563, 31086310, 32662773, 33087775

[GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)]_(n)-diphospho-di-trans,octa-cis-undecaprenol + β-D-GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)-diphospho-di-trans,octa-cis-undecaprenol --> [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)]_(n+1)-diphospho-di-trans-octa-cis-undecaprenol + di-trans,octa-cis-undecaprenyl diphosphate + H⁺ (according to UniProt)

Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)

contributes to the control of cell diameter (cell diameter increases with PonA levels), acts antogonistically to the [SW|Rod complex] [pubmed|31086310]

N-terminal part: [SW|glycosyltransferase 51 family] (according to UniProt)

C-terminal part: [SW|transpeptidase family] (according to UniProt)

[[protein|PbpD]], [[protein|PbpF]], [[protein|PbpG]]

Fibronectin type-III (aa 708-795) (according to UniProt)

[PDB|3DWK] (from Staphylococcus aureus, aa 71 ... 656, 38% identity) [pubmed|18760285]

BKE22320 ([[gene|ponA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATCTCAACCTTTCG, downstream forward: _UP4_TAAACAAAAAAGCCGTCACC

BKK22320 ([[gene|ponA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATCTCAACCTTTCG, downstream forward: _UP4_TAAACAAAAAAGCCGTCACC

2083 [[gene|trpC]]2 [[gene|ponA]]::pSG1492 (cat P_xyl-gfpa-[[gene|ponA]]1-394) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [http://bgsc.org BGSC]

[SW|Jeff Errington], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/jeff.errington homepage]